Posts

What part of the RNA polymerase holoenzyme recognizes the consensus sequence?

Biology homework help
Biology 351- Homework Assignment #5 (10 points)
This assignment is due on Tuesday February 20th in lab by 11:21AM. Give yourself enough time to print out your assignment in case you have printer problems. I will not accept electronic copies. Hardcopies only, and late assignments are not accepted in the biology department.
1. During transcriptional initiation RNA polymerase holoenzyme recognizes the consensus sequences within the promoter of E. coli. What part of the RNA polymerase holoenzyme recognizes the consensus sequence?
2. Does RNA polymerase holoenzyme recognize the sense, or antisense strand? The antisense strand is used for what purpose during transcription?
3. A single strand of bacterial DNA contains the base sequence
-35 -10 +1
5’ CGTGTATTGACACTGGTGAGCCACTATCGTATATTCCCTAAGTGAGTATTGG 3’
a. What is the complementary sequence? Draw or type this sequence just below and indicate its polarity (directionality) in order to create a double-stranded DNA sequence.
b. Under the double-stranded DNA sequence, draw or type the mRNA sequence that will be translated, and indicate its polarity.
c. Which strand of the DNA serves as the coding strand, and which serves as the template strand, for the synthesis of the RNA transcript for this hypothetical gene fragment.

4. If a stop codon is not included in the mRNA molecule, how would this affect the following:

a. translocation on the mRNA by polyribosomes

b. concentration of this specific polypeptide in the cell

5. How many different types of tRNA molecules exist in the cell? For what purpose (hint: why are there 20 different tRNA molecules)?

What measures would you suggest in the plan to actually reduce health risks?

Biology homework help
Using the South University Online Library or the Internet, conduct an independent research on the selected disease. Based on your research and understanding, create an 8 to 10 page report in a Microsoft Word document, which include a public education and disease control plan for your identified disease.
Infectious diseases come with extremely tough challenges to mitigate them and then finally get them under control. Bringing any such infectious disease under control involves a lot of decisions and cooperation between various branches of government and the health services.
Using the South University Online Library or the Internet, choose an infectious disease that was prevalent in the United States and had lasting consequences or select a disease from the following:

  • AIDS/HIV
  • Cholera
  • Influenza
  • Malaria
  • Tuberculosis
  • West Nile Fever
  • Yellow fever

Your paper must address the following:

  • A brief description of your chosen infectious disease along with your reasons for choosing the disease.
  • Information on the work conducted by government departments to mitigate the impact of your chosen infectious disease.
  • Investigations, research studies, and other surveillance data analyses regarding your chosen infectious disease.
  • Instances of the emergence and re-emergence of your chosen disease.
  • A brief summary of the government’s findings and investigations about your chosen disease.
  • Past, current, and ongoing research pertaining to your chosen disease.
  • What percentage of population was affected by the disease?
  • Have there been instances of any historical outbreaks of the disease? How was the disease handled and controlled in your community?
  • What were the objectives and goals of your public education plan to control this disease?
  • What initiatives were taken by the government departments to mitigate the impact of the disease?
  • What measures would you suggest in the plan to actually reduce health risks?
  • How would the plan allow the public to recognize pathogens are related to the cause of diseases and other health problems?
  • How would the plan suggest measures to prevent the outbreak of the chosen infectious disease?

You must explain the feasibility of each specific part of your plan. Support your responses with examples. Cite any sources in APA format.

compare and contrast the political environment during the Clinton Healthcare legislative failure and the Obama Healthcare legislative success.

Biology homework help
 After reading chapter 10 case study in the McLaughlin & McLaughlin text, compare and contrast the political environment during the Clinton Healthcare legislative failure and the Obama Healthcare legislative success. Utilize figure 10-1 and 10-2 to identify all the possible agencies involved in the debate and the strengths and weaknesses of each. Support your conclusions with content from your textbook and outside readings.
 
Your thread is due by 11:59 p.m. (ET) on Thursday, and your two replies are due by 11:59 p.m. (ET) on Saturday.
I need one Main Post (Minimum 400 words) and two Responses (200-250 Words each)
Below are the specific requirements for each part of this assignment.
THREADS:
· Must be at least 400 words.
· A minimum of one source is required (course textbook may be used).
· Citations used should be formatted in APA.
· Should thoroughly address the topic prompt, using citations as appropriate.
REPLIES:
· Must post at least two 200–250-word replies to your classmates per forum.
· Should expand upon ideas expressed in your classmates’ threads by adding new ideas to points that you agree with and/or explaining areas of disagreement.
· Should be posted intermittently throughout the forum.  Do not complete all of the replies at one time; instead, allow for conversation to develop by posting multiple times throughout the week.
· A minimum of one source per reply is required (course textbook may be used).
· Citations used should be formatted in APA.
I have attached the Discussion Rubic as to how the Main post and Responses would be Graded. Please follow every single Instruction.
I have also attached the Main post of two students you need to respond to. Please send me the main post as well as the responses
Required Resources:
McLaughlin, C. P., & McLaughlin, C. D. (2015). Health policy analysis: An interdisciplinary approach (2nd ed.). Sudbury, MA: Jones and Bartlett. ISBN: 9781284037777.
American Psychological Association. Publication manual of the American Psychological Association (Current ed.). Washington, DC: Author.
Iverson, C, Christiansen, S, & Flanagin, A. AMA Manual of Style: A Guide for Authors and Editors Current ed. New York, NY: Oxford University Press.

Explain how animal cells make energy for cellular processes

Biology homework help
University of Phoenix Material

Cell Biology Worksheet

Part I: Foundations of Cell Biology

Respond to the prompts in the tables below. Each response should be at least 30 words. Cite any references that you use.

Foundations of Chemisty in Biology

Prompt Your response
Describe an example of a chemical reaction that occurs in the body.

Plant Cells

Prompt Your response
Describe the primary structures in plant cells.
Explain the role of each structure in plant cells.
Explain how plant cells make energy for cellular processes.

Animal Cells

Prompt Your response
Describe the primary structures in animal cells.
Explain the role of each structure in animal cells.
Explain how animal cells make energy for cellular processes.

Bacterial Cells

Prompt Your response
Describe the primary structures in bacteria cells.
Explain the roles of each structure in bacteria cells.
Explain how bacteria cells make energy for cellular processes.
How are plant cells, animal cells, and bacteria cells different?


Part II: Applying The Scientific Method to Everyday Life

Recently, Earl attended a picnic at his daughter’s school. The picnic was a potluck, and the food was served outdoors. Contributions included hamburgers, hot dogs, baked beans, potato chips, potato salad, coleslaw, apple pie, and vanilla ice cream. Within 24 hours of the picnic, several attendees developed symptoms of food poisoning. Of the 50 people who attended the picnic, only 30 people became ill. Every person at the picnic ate something, but not every person had an opportunity to sample each item. Earl noticed that the potato salad he started to eat was warm. He also noticed that his hamburger was somewhat pink in the middle and not fully cooked. Earl wonders if eating the hamburgers or the potato salad could be responsible for making some attendees ill. Earl has begun to apply the scientific method to this common problem. Answer each of the following prompts in at least 75 words.

Prompt Your response
What is Earl’s hypothesis? How did Earl create his hypothesis?
Describe the steps of the scientific method Earl utilized.
How could Earl use the scientific method to create an experiment to determine which food sources made people sick?


References

Cited in APA Format

Copyright © XXXX by University of Phoenix. All rights reserved.

Copyright © 2017 by University of Phoenix. All rights reserved.