Examine the case of Baby Boy Doe (Darr, 2011, p. 16.) The objective of this assignment is to get you to think critically about real-life ethical dilemmas and the moral principals involved

Assignment Instructions
Examine the case of Baby Boy Doe (Darr, 2011, p. 16.) The objective of this assignment is to get you to think critically about real-life ethical dilemmas and the moral principals involved. There is no right or wrong answer, just try to look at this case subjectively. Most of the time, resolving ethical dilemmas is not so “black and white.” Discuss arguments for and against the issues below
1. Discuss what makes this an ethical dilemma (read pp. 3 and 4).
2. Discuss the implications of this study in terms of the moral principles described in chapter 1.
Here are some questions that may guide your thinking:
Respect for persons: Did the hospital/ physicians allow the parents to be autonomous in their decision-making? Do you see any elements of paternalism on behalf of the physicians?
Beneficence: Did the hospital/ physicians act beneficently?
Nonmaleficence: Did the hospital/ physicians consider nonmaleficence?
Justice: Did the hospital act in a just way?
3. Finally, do you think that the hospital did all that it could in this situation? Did it act appropriately? Explain.
Assignments are to be a minimum of 2 full pages of text and 3 reputable references in proper APA format.
Reference: Darr, K. (2011). Ethics in Health Services Management. (5th Edition). Baltimore, MD: Health Professions Press, Inc.
*******************************************************************************************************************************************************************************************************
Assignment Instructions:
Please review the Weekly Assignment Grading IRubric prior to submission (Click on View IRubric iRubric Link in the main Assignment List page).
Assignments are due in the Assignment portion of the classroom by Sunday, 11:55 p.m. EST each week. Make sure you read and understand the directions and requirements for each Assignment. Please ensure you cite your references in APA format with a minimum of 3 references (You may use your textbook as a reference and you should have a minimum of 2 academic outside references). Assignment will be graded based on the following areas: Foundation and synthesis of knowledge, application of knowledge critical thinking, writing skills, and organization of ideas and format. Refer to Library Online Resource Center for any research assistance. Refer to the Student Handbook for policies relevant to academic honesty and other procedures and policies related to this course. Assignments submitted late without advance notice will receive a 5% per day late penalty and will not be accepted for grading five (5) days past the due date.

explain the role that biology plays in the development of mood disorders, including one’s genetic vulnerability and the effects of different levels of brain chemicals and transmitter substances

Write a 1-2 page essay explaining the role that biology plays in the development of mood disorders, including one’s genetic vulnerability and the effects of different levels of brain chemicals and transmitter substances; define the term endogenous; and discuss the following psychological explanations for mood disorders: a. the psychoanalytic theory of repressed anger; b. the behavioral theory of learned helplessness; c. the cognitive theory that emphasizes self-defeating thinking patterns; and d. the effects of social and environmental stresses.

Create a hypothetical organizational philosophy statement. Include a mission statement, vision statement, and core principles/values

Week 2 Developing an Organizational Philosophy and Mission Statement
Assignment Instructions
Darr writes, ” To transform the organization so that its culture is a living reflection of values that facilitate the mission and vision, management must know what values are present in the culture” (2011, p. 56). 
Create a hypothetical organizational philosophy statement. Include a mission statement, vision statement, and core principles/values.  Assignments are to be a minimum of 2 full pages of text and 3 reputable references in proper APA format.
Reference:
Darr, K. (2011).  Ethics in Health Services Management.  (5th Edition).  Baltimore, MD:  Health Professions Press, Inc.
*******************************************************************************************************************************************************************************************************
Assignment Instructions:
Please review the Weekly Assignment Grading IRubric prior to submission (Click on View IRubric     in the main Assignment List page).
Assignments are due in the Assignment portion of the classroom by Sunday, 11:55 p.m. EST each week. Make sure you read and understand the directions and requirements for each Assignment. Please ensure you cite your references in APA format with a minimum of 3 references (You may use your textbook as a reference and you should have a minimum of 2 academic outside references).  Assignment will be graded based on the following areas: Foundation and synthesis of knowledge, application of knowledge critical thinking, writing skills, and organization of ideas and format.  Refer to Library Online Resource Center for any research assistance.  Refer to the Student Handbook for policies relevant to academic honesty and other procedures and policies related to this course. Assignments submitted late without advance notice will receive a 5% per day late penalty and will not be accepted for grading five (5) days past the due date.   

Explain why a secondary antibody response to an antigen may prevent a bacterial or viral disease when the primary adaptive immune response to that antigen did not protect the person from the disease.

This is an open-book take-home final exam. The exam is cumulative and covers all five of the course modules and the related conference topics and activities.
Your exam must be submitted to your assignment folder “Final Exam: no later than 11:59 p.m. Eastern Time, July 24. Late submissions will not be graded and will earn 0 points. Email, scanned, and PDF copies are not acceptable.
There are three (3) parts to the final exam with a total possible100 points:
Part A. Multiple Choice (20 questions for 1 point each)
Part B. Short Answer (4 questions for 5 points each)
Part C. Short Essay (6 questions for 10 points each)
Responses to Parts B and C must be written as complete sentences and in your own words (see Purdue Online Writing Lab (OWL), “Paraphrase: Write in Your Own Words” (https://owl.english.purdue.edu/owl/resource/563/02/ ). You must include complete citations in APA style for the sources of your information (see additional instructions about citations in week 8 Course Content “About the Final Exam”. No points will be earned for answers that do not include complete and accurate citations for the sources of information used to answer the question or that support your answer.
Submit your answers as a Word attachment (Start the file name of the attachment with your last name-for example student John Smith would be Smith J.Final Exam. doc); points will be deducted for not doing so.
Part A Multiple Choice: Select the best or most complete answer (1 point each)
In the lab you use the gram staining procedure, a differential staining technique, as a first step in identifying the type of bacteria on a slide. After you carefully perform the staining procedure, you look at the cells under the microscope and see purple rod shaped cells. This result indicates that
the cells have a thick peptidoglycan layer as part of the physical structure of the cell wall and are gram-positive bacilli.
the cells have a thin peptidoglycan layer as part of the physical structure of the cell wall and are gram-positive bacilli.
the cells have a thin peptidoglycan layer as part of the physical structure of the cell wall and are gram-negative cocci.
the cells have a thin peptidoglycan layer as part of the physical structure of the cell wall and are gram-negative bacilli.
the cells have a thick peptidoglycan layer as part of the physical structure of the cell wall and are gram-negative bacilli.
Which of the following infectious diseases has (or have) been eradicated in the world?
polio
measles
smallpox
whooping cough
all of the above
Which of the followings is a characteristic of prions that is unique from other known pathogenic microbes?
They lack the characteristics of a classic cell.
They can be transmitted from animals to man.
They cause permanent damage to the host.
They are made entirely of protein.
The first microorganism demonstrated to satisfy Koch’s postulates (in the late 19th century) was
Mycobacterium tuberculosis
Bacillus anthracis
Mycobacterium leprae
Vibrio cholera
Which of the following is a characteristic of the adaptive immune response and not of the innate immune response?
Physical and chemical barriers
Clonal expansions of activated B cells
Inflammatory mediators
Phagocytosis
What does each codon in messenger RNA (mRNA) specify?
a nucleotide
an enzyme
an amino acid
a promoter
Antigens are
specific.
proteins or polysaccharides (complex sugars).
recognized as foreign by the body’s immune system.
all of the above.
Oncogenes are genes that
the virus utilizes to replicate itself.
transform normal cells to cancer cells.
promote genetic recombination in bacteria.
influence ongoing protein production.
Genes A, B, and C are three structural genes of an operon and fall in that order within the operon. A mutation occurs in Gene A that halts transcription early in the gene. What effect will this have on the levels of proteins produced by Genes A, B, and C?
No proteins coded by genes A, B, and C will be produced.
Proteins coded by genes B and C, but not gene A, will be produced
Proteins coded by genes A, B, and C will be produced.
Only proteins coded by gene A will be produced.
Plasmids
replicate with the bacterial chromosome.
may contain antibiotic resistance genes.
are as large as the bacterial chromosome.
contain genes essential for growth.
Interferons are an important part of the host defense against viral infections. Their principal mode of action is that
they trigger the synthesis of one or more cellular proteins that inhibit viral replication.
they are present in the serum of healthy individuals and act as viral surveillance factors.
they coat viral particles and block their attachment to cells.
they protect the death of a viral-infected cell.
The form of genetic exchange by which donor DNA is introduced into a recipient bacterial cell by a bacterial virus is
transformation.
conjugation.
transduction.
transfection.
vertical transfer.
Viruses usually initiate infection by first interacting with receptors on the surface of cells. Which of the following statements is most accurate about cellular receptors for viruses?
Cellular receptors for viruses have no known function.
All viruses within a given family use the same cellular receptor.
All cells in a susceptible host will express the viral receptor.
Successful infection of a cell by a virus may involve the interaction with more than one type of receptor.
What was Edward Jenner’s contribution to microbiology?
He discovered how to create a vaccine to trigger the body’s immune system to develop antibodies that fight microbes.
He proposed the germ theory.
He developed the compound microscope.
He developed the binomial nomenclature system.
The production of RNA using DNA as a template is known as
transduction.
transformation.
transcription
translation.
Humoral immunity involves the secretion of antibodies from
T cells.
macrophages.
neutrophils.
plasma cells.
Which of the following describes the correct relationship between the major structures of a virus?
The envelope encloses the genome of the virus.
The capsid encloses the genome of the virus.
The capsid encloses the envelope of the virus.
The genome encloses the capsid of the virus.
Immunity that results when a person is vaccinated against the 2009-H1N1 influenza is
active artificially acquired immunity.
passive naturally acquired immunity.
active naturally acquired immunity.
passive artificially acquired immunity.
What are some benefits of our microbiome?
It can supply essential nutrients.
It can aid in preventing the colonization of pathogens.
It can ensure proper functioning of the host immune systems
It can aid in food digestion.
All of the above
Protein toxins that may interfere with host cell function or damage host cell membranes and are usually secreted by living bacteria are called
adhesion factors.
antibodies.
exotoxins
endotoxins.
Part B. Short Answer (5 points each)
Answer the questions below as completely and as thoroughly as possible and where appropriate include a specific example to illustrate. Answer the question in essay form (not as an outline or as bullets) using complete sentences. Cite sources of information you used to answer the questions or that support your answer.
Explain how genetic information is transferred from DNA to RNA to proteins. Include the terms DNA replication, transcription, translation, the principal events and enzymes. Use the following DNA molecule to illustrate each stage.
3′ TACTAGCCACATCTACCGATC 5′ Template strand used for transcription
5′ ATGATCGGTGTAGATGGCTAG 3′ Coding (“inactive” strand)
An electron micrograph shows a structure with a rigid outer wall, a membrane, ribosomes, a nonmembrane bound nuclear area, and no endoplasmic reticulum or mitochondria. Explain why the structure is or is not each of the following: a human T cell, a virus, a bacterial cell, a yeast cell.
Describe the difference between an emerging and a re-emerging disease and give a recent example of a viral or a bacterial infection of each and explain the reason for that classification.
Name the four types of acquired immunity and describe the mechanisms by which a person acquires the immunity (“how it is conferred”). In a table describe the following characteristics for each them: type of immunizing agent (antibodies or antigen), relative time for immunity to appear, relative time the immunity lasts, and the source of antibodies (for example, self or non-self) that act against a pathogen or other antigen
Part C. Short Essay (10 points each)
Answer the questions below as completely and as thoroughly as possible and where appropriate include a specific example to illustrated. Answer the question in essay form (not as an outline or as bullets) using complete sentences. You may use diagrams to supplement your answers, but a diagram alone without appropriate discussion will not be adequate for full credit. Cite sources of information you used to answer the questions or that support your answer.
Your doctor diagnosed your illness as a bacterial sinus infection and prescribed a course of antibiotics. You also gave informed consent to participate in the doctor’s research study on antibiotics. As part of the study you went to the clinic every day to have a sample from the infection taken and analyzed. Before starting on the antibiotics the bacteria were susceptible to the antibiotic; however later in the week after starting the antibiotic treatment the bacteria in your infection were resistant to the antibiotic. Results of DNA analysis of the bacteria causing your infection showed that the resistant bacteria and susceptible bacteria differed only by a gene that encodes the protein target of the antibiotic such that the antibiotic was unable to bind to the target site on the resistant bacterial cells..
Which of the following three hypotheses is most likely? Explain how the results support that hypothesis and what you learned about antibiotic resistance in week 4 topic “Antibiotic Resistance”. What is a possible mechanism for the change in the gene?
A) You developed a tolerance* for the antibiotic
B) The bacteria infecting you developed a tolerance* for the antibiotic.
C) The bacteria infecting you evolved to be resistant to the antibiotic.
*Tolerance is a nongenetic change in which the response to a specific drug and concentration is weaker after repeated use.
Describe how the first and second lines of defense of your innate immune system can protect you from an influenza A infection. Recall from week 7 course content topic “About Influenza Viruses” that influenza is a respiratory disease. Be specific about the tissues, cells, and processes involved and as related to influenza or other respiratory viral diseases. You might find “The Innate Immune System Study Guide” in course Module 5 helpful.
List the stages of the viral life cycle and briefly describe the principal events in the stages of the life cycle of a virus in the Retroviridae family and explain what makes viruses in that family difficult to eliminate from the host. Name a virus in that family.
Explain why a secondary antibody response to an antigen may prevent a bacterial or viral disease when the primary adaptive immune response to that antigen did not protect the person from the disease. Be specific about the type of cells and products involved in the responses.
Read the following Science Daily article:
Write a brief summary (one paragraph) about the study that answers the following questions: What was the purpose of the clinical trial? What was the overall design of the trial? What were the independent and dependent variables? What was the control and was it a positive or a negative control? What were the results of the experiments and the major importance of the findings? Did the trial demonstrate that the vaccine prevented dengue? Why or why not? Summarize the results in a table. In your summary explain the following terms: virus challenge study, viremia, and attenuated vaccine.